shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(2700062C07Rik-shRNA-Seq1)(CAT#: AdV-SI3924WQ)

This product is a 2700062C07Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 2700062C07Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 2700062C07Rik-shRNA-Seq1
Related Target/Protein 2700062C07Rik
Region CDS
TargetSeq GAAACACTTCTCTCAACTAAA
NCBI RefSeq NM_026529
Alternative Names C87515; AI195775
Titer >1*10^10 GC/mL
Target Gene
Gene ID 68046
Uniprot ID A0A3Q4EGR9

Related Products