shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Adipor1-shRNA-Seq2)(CAT#: AdV-SI3534WQ)

This product is a Adipor1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Adipor1 gene encodes a protein which acts as a receptor for adiponectin, a hormone secreted by adipocytes which regulates fatty acid catabolism and glucose levels. The expression of Adipor1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Adipor1-shRNA-Seq2
Related Target/Protein Adipor1
Region CDS
TargetSeq GCTGAAAGACAACGACTACCT
NCBI RefSeq NM_028320
Alternative Names CGI45; PAQR1; ACDCR1; CGI-45; TESBP1A
Titer >1*10^10 GC/mL
Related Diseases Obesity; Diabetes
Target Gene
Gene ID 51094
Uniprot ID Q96A54

Related Products