shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Adm2-shRNA-Seq4)(CAT#: AdV-SI3664WQ)
This product is a Adm2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Adm2 gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis. The expression of Adm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Adm2-shRNA-Seq4 |
| Related Target/Protein | Adm2 |
| Region | CDS |
| TargetSeq | GATTCCTTCCAGTAACCTGCA |
| NCBI RefSeq | NM_182928 |
| Alternative Names | AM2; dJ579N16.4 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Gastrointestinal and cardiovascular disease |