shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Adm2-shRNA-Seq4)(CAT#: AdV-SI3664WQ)

This product is a Adm2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Adm2 gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis. The expression of Adm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Adm2-shRNA-Seq4
Related Target/Protein Adm2
Region CDS
TargetSeq GATTCCTTCCAGTAACCTGCA
NCBI RefSeq NM_182928
Alternative Names AM2; dJ579N16.4
Titer >1*10^10 GC/mL
Related Diseases Gastrointestinal and cardiovascular disease
Target Gene
Gene ID 79924
Uniprot ID Q7Z4H4

Related Products