shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(APBA3-shRNA-Seq1)(CAT#: AdV-SI1313WQ)
This product is a APBA3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by APBA3 gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. The expression of APBA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | APBA3-shRNA-Seq1 |
| Related Target/Protein | APBA3 |
| Region | CDS |
| TargetSeq | CTATGGCGAGGTGCATATCAA |
| NCBI RefSeq | NM_004886 |
| Alternative Names | X11L2; mint3; MGC:15815 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Alzheimer's disease |
