shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(ARMC4-shRNA-Seq1)(CAT#: AdV-SI1089WQ)
This product is a ARMC4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The ARMC4 gene encoded protein contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. The expression of ARMC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | ARMC4-shRNA-Seq1 |
Related Target/Protein | ARMC4 |
Region | 3UTR |
TargetSeq | GTTGTTAGCAAACCCTTTCAA |
NCBI RefSeq | NM_018076 |
Alternative Names | CILD23 |
Titer | >1*10^10 GC/mL |
Related Diseases | Primary ciliary dyskensia (PCD) |