shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Bcdin3d-shRNA-Seq1)(CAT#: AdV-SI3950WQ)
This product is a Bcdin3d-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Bcdin3d gene encodes an RNA methyltransferase which belongs to the rossmann fold methyltransferase family, and serves as a 5'-methylphosphate capping enzyme that is specific for cytoplasmic histidyl tRNA. The expression of Bcdin3d-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Bcdin3d-shRNA-Seq1 |
| Related Target/Protein | Bcdin3d |
| Region | CDS |
| TargetSeq | CTCTGTACAAACATTTCCTTT |
| NCBI RefSeq | NM_029236 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |