shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Bcdin3d-shRNA-Seq1)(CAT#: AdV-SI3950WQ)
This product is a Bcdin3d-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Bcdin3d gene encodes an RNA methyltransferase which belongs to the rossmann fold methyltransferase family, and serves as a 5'-methylphosphate capping enzyme that is specific for cytoplasmic histidyl tRNA. The expression of Bcdin3d-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Bcdin3d-shRNA-Seq1 |
Related Target/Protein | Bcdin3d |
Region | CDS |
TargetSeq | CTCTGTACAAACATTTCCTTT |
NCBI RefSeq | NM_029236 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |