shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(C10orf62-shRNA-Seq2)(CAT#: AdV-SI1164WQ)

This product is a C10orf62-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C10orf62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C10orf62-shRNA-Seq2
Related Target/Protein C10orf62
Region CDS
TargetSeq GACAAGTCACCAGAATCCCAT
NCBI RefSeq NM_001009997
Alternative Names bA548K23.1
Titer >1*10^10 GC/mL
Related Diseases Testis cancer
Target Gene
Gene ID 414157
Uniprot ID Q5T681

Related Products