shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(C12orf32-shRNA-Seq2)(CAT#: AdV-SI1401WQ)

This product is a C12orf32-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C12orf32 gene plays a role in DNA damage response (DDR) signaling upon genotoxic stresses such as ionizing radiation (IR) during the S phase. The expression of C12orf32-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C12orf32-shRNA-Seq2
Related Target/Protein C12orf32
Region CDS
TargetSeq CCCGAGGACAAGTATGGAATA
NCBI RefSeq NM_031465
Alternative Names RHINO; RHNO1; HKMT1188
Titer >1*10^10 GC/mL
Related Diseases DNA damage response (DDR)
Target Gene
Gene ID 83695
Uniprot ID Q9BSD3

Related Products