shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(C4orf37-shRNA-Seq1)(CAT#: AdV-SI1334WQ)

This product is a C4orf37-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C4orf37 gene may be associated with male factor infertility. The expression of C4orf37-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C4orf37-shRNA-Seq1
Related Target/Protein C4orf37
Region CDS
TargetSeq CCTGCTGATTATCAGGAATTT
NCBI RefSeq NM_174952
Alternative Names STPG2
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 285555
Uniprot ID Q8N412

Related Products