shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(C4orf41-shRNA-Seq1)(CAT#: AdV-SI1243WQ)
This product is a C4orf41-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by C4orf41 gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. The expression of C4orf41-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C4orf41-shRNA-Seq1 |
| Related Target/Protein | C4orf41 |
| Region | CDS |
| TargetSeq | GCTGCCATCTCTCAACATCAA |
| NCBI RefSeq | NM_021942 |
| Alternative Names | GRY; FOIGR; LGMD2S; TRAPPC11; LGMDR18 |
| Titer | >1*10^10 GC/mL |