shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(CASC4-shRNA-Seq2)(CAT#: AdV-SI1119WQ)
This product is a CASC4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The increased expression level of CASC4 gene is associated with HER-2/neu proto-oncogene overexpression. Amplification and resulting overexpression of this proto-oncogene are found in approximately 30% of human breast and 20% of human ovarian cancers. The expression of CASC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | CASC4-shRNA-Seq2 |
| Related Target/Protein | CASC4 |
| Region | CDS |
| TargetSeq | GAATGAAGAACCCTCAAGCAA |
| NCBI RefSeq | NM_138423 |
| Alternative Names | H63 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Ovarian cancers, Breast cancer |