shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Cenpc1-shRNA-Seq6)(CAT#: AdV-SI3444WQ)
This product is a Cenpc1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Cenpc1 gene is a centromere autoantigen and a component of the inner kinetochore plate. The encoded protein is required for maintaining proper kinetochore size and a timely transition to anaphase. The expression of Cenpc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Cenpc1-shRNA-Seq6 |
| Related Target/Protein | Cenpc1 |
| Region | CDS |
| TargetSeq | CCAAATGTTCGTCGATCTAAT |
| NCBI RefSeq | NM_007683 |
| Alternative Names | MIF2; hcp-4; CENP-C; CENPC |
| Titer | >1*10^10 GC/mL |