shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(CEP76-shRNA-Seq1)(CAT#: AdV-SI1239WQ)
This product is a CEP76-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CEP76 gene encodes a centrosomal protein which regulates centriole amplification by limiting centriole duplication to once per cell cycle. The expression of CEP76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | CEP76-shRNA-Seq1 |
| Related Target/Protein | CEP76 |
| Region | CDS |
| TargetSeq | CACATTTAAAGGGTTCCCAAT |
| NCBI RefSeq | NM_024899 |
| Alternative Names | C18orf9; HsT1705 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Centriole reduplication |