shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Cma2-shRNA-Seq1)(CAT#: AdV-SI3920WQ)
This product is a Cma2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Zcchc5 gene has serine-type endopeptidase activity. The expression of Cma2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Cma2-shRNA-Seq1 |
Related Target/Protein | Cma2 |
Region | 3UTR |
TargetSeq | CATCAGAGTCTTCAAGCCAGA |
NCBI RefSeq | NM_001024714 |
Alternative Names | Mcp10 |
Titer | >1*10^10 GC/mL |
Target Gene | |
---|---|
Gene ID | 545055 |
Uniprot ID | A0A2I3BR33 |