shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Cma2-shRNA-Seq1)(CAT#: AdV-SI3920WQ)
This product is a Cma2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Zcchc5 gene has serine-type endopeptidase activity. The expression of Cma2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Cma2-shRNA-Seq1 |
| Related Target/Protein | Cma2 |
| Region | 3UTR |
| TargetSeq | CATCAGAGTCTTCAAGCCAGA |
| NCBI RefSeq | NM_001024714 |
| Alternative Names | Mcp10 |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 545055 |
| Uniprot ID | A0A2I3BR33 |
