shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(COQ9-shRNA-Seq1)(CAT#: AdV-SI1121WQ)

This product is a COQ9-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The COQ9 gene encoded protein is likely necessary for biosynthesis of coenzyme Q10, as mutations at this locus have been associated with autosomal-recessive neonatal-onset primary coenzyme Q10 deficiency. The expression of COQ9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert COQ9-shRNA-Seq1
Related Target/Protein COQ9
Region CDS
TargetSeq CAGTGGAAACCAGACTGAGAA
NCBI RefSeq NM_020312
Alternative Names COQ10D5; C16orf49; HSPC326; PSEC0129
Titer >1*10^10 GC/mL
Related Diseases Autosomal-recessive neonatal-onset primary coenzyme Q10 deficiency
Target Gene
Gene ID 57017
Uniprot ID O75208

Related Products