shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Ctu2-shRNA-Seq4)(CAT#: AdV-SI3491WQ)
This product is a Ctu2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Ctu2 gene a protein which is involved in the post-transcriptional modification of transfer RNAs (tRNAs) and plays a role in thiolation of uridine residue present at the wobble position in a subset of tRNAs, resulting in enhanced codon reading accuracy. The expression of Ctu2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Ctu2-shRNA-Seq4 |
| Related Target/Protein | Ctu2 |
| Region | CDS |
| TargetSeq | GATCCTGGAGAACACTGGTTT |
| NCBI RefSeq | NM_153775 |
| Alternative Names | MFRG; NCS2; UPF0432; C16orf84 |
| Titer | >1*10^10 GC/mL |