shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(DHX8-shRNA-Seq2)(CAT#: AdV-SI1028WQ)
This product is a DHX8-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by DHX8 gene contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus.The expression of DHX8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | DHX8-shRNA-Seq2 |
| Related Target/Protein | DHX8 |
| Region | CDS |
| TargetSeq | AGACAGAGATAGGGAACGAAA |
| NCBI RefSeq | NM_004941 |
| Alternative Names | DDX8; Dhr2; HRH1; PRP22; PRPF22 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | HIV infection |