shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(DOLK-shRNA-Seq1)(CAT#: AdV-SI1468WQ)
This product is a DOLK-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by DOLK gene catalyzes the CTP-mediated phosphorylation of dolichol, and is involved in the synthesis of Dol-P-Man. The expression of DOLK-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | DOLK-shRNA-Seq1 |
Related Target/Protein | DOLK |
Region | CDS |
TargetSeq | GCCTTTGCTTGGACTAGTCAT |
NCBI RefSeq | NM_014908 |
Alternative Names | DK; DK1; CDG1M; SEC59; TMEM15 |
Titer | >1*10^10 GC/mL |
Related Diseases | Dolichol kinase deficiency |