shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(EWSR1-shRNA-Seq1)(CAT#: AdV-SI1036WQ)
This product is a EWSR1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The EWSR1 gene encodes a multifunctional protein that is involved in various cellular processes, including gene expression, cell signaling, and RNA processing and transport. The expression of EWSR1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | EWSR1-shRNA-Seq1 |
| Related Target/Protein | EWSR1 |
| Region | 3UTR |
| TargetSeq | TGCATTGACTACCAGATTTAT |
| NCBI RefSeq | NM_005243 |
| Alternative Names | EWS; EWS-FLI1; bK984G1.4 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Ewing sarcoma as well as neuroectodermal tumors |