shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Fam166a-shRNA-Seq2)(CAT#: AdV-SI3433WQ)

This product is a Fam166a-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Fam166a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Fam166a-shRNA-Seq2
Related Target/Protein Fam166a
Region CDS
TargetSeq CATTGAGGACTTCAGCAAATC
NCBI RefSeq NM_026624
Alternative Names HSD46
Titer >1*10^10 GC/mL
Target Gene
Gene ID 401565
Uniprot ID Q6J272

Related Products