shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(FAM23B-shRNA-Seq1)(CAT#: AdV-SI1356WQ)
This product is a FAM23B-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of FAM23B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | FAM23B-shRNA-Seq1 |
| Related Target/Protein | FAM23B |
| Region | CDS |
| TargetSeq | CCTACCAAGGAACAAGGGCTA |
| NCBI RefSeq | NM_001013629 |
| Alternative Names | FAM23A; TMEM236; bA16O1.2; bA162I21.2 |
| Titer | >1*10^10 GC/mL |
