shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(FAM45B-shRNA-Seq1)(CAT#: AdV-SI3893WQ)

This product is a FAM45B-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of FAM45B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert FAM45B-shRNA-Seq1
Related Target/Protein FAM45B
Region 3UTR
TargetSeq CGAAGTGCTATAACTACTTTA
NCBI RefSeq NM_018472
Alternative Names HT011; DENND10P1; FAM45BP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55855
Uniprot ID Q6NSW5

Related Products