shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(FAM53C-shRNA-Seq1)(CAT#: AdV-SI3221WQ)

This product is a FAM53C-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by FAM53C gene belongs to the FAM53 protein family. FAM53 protein family members bind to a transcriptional regulator that modulates cell proliferation. Alternative splicing results in multiple transcript variants. The expression of FAM53C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert FAM53C-shRNA-Seq1
Related Target/Protein FAM53C
Region 3UTR
TargetSeq GCAGCCTATGATTGCTTCTTT
NCBI RefSeq NM_016605
Alternative Names C5orf6
Titer >1*10^10 GC/mL
Related Diseases Prostate cancer
Target Gene
Gene ID 51307
Uniprot ID Q9NYF3

Related Products