shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(FBXL16-shRNA-Seq2)(CAT#: AdV-SI3214WQ)
This product is a FBXL16-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by FBXL16 belongs to the F-box protein family and they interact with ubiquitination targets through other protein interaction domains. The expression of FBXL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | FBXL16-shRNA-Seq2 |
Related Target/Protein | FBXL16 |
Region | 3UTR |
TargetSeq | GCTGTTGAATCAGAAACAGAT |
NCBI RefSeq | NM_153350 |
Alternative Names | Fbl16; C16orf22; c380A1.1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Ductal Carcinoma |