shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Fbxw16-shRNA-Seq2)(CAT#: AdV-SI3537WQ)
This product is a Fbxw16-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Fbxw16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Fbxw16-shRNA-Seq2 |
| Related Target/Protein | Fbxw16 |
| Region | 3UTR |
| TargetSeq | GCCTACTATCACTTGGGTGTT |
| NCBI RefSeq | NM_177070 |
| Alternative Names | 7420402K12Rik |
| Titer | >1*10^10 GC/mL |
