shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(GEMIN8-shRNA-Seq2)(CAT#: AdV-SI1172WQ)
This product is a GEMIN8-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by GEMIN8 gene is part of the SMN complex, which is necessary for spliceosomal snRNP assembly in the cytoplasm and pre-mRNA splicing in the nucleus. The expression of GEMIN8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | GEMIN8-shRNA-Seq2 |
Related Target/Protein | GEMIN8 |
Region | CDS |
TargetSeq | CCTCAGTCCTTCTATGACCAT |
NCBI RefSeq | NM_017856 |
Alternative Names | FAM51A1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Survival motor neuron (SMN) |