shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(GLOD4-shRNA-Seq2)(CAT#: AdV-SI1145WQ)

This product is a GLOD4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. Transfection of GLOD4 gene in hepatocellular carcinoma cells and overexpression can inhibit the cell growth. The expression of GLOD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert GLOD4-shRNA-Seq2
Related Target/Protein GLOD4
Region 3UTR
TargetSeq CGAGCTTCTTTCTGTGTATAT
NCBI RefSeq NM_016080
Alternative Names HC71; CGI-150; C17orf25
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular carcinoma
Target Gene
Gene ID 51031
Uniprot ID Q9HC38

Related Products