shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Gm16776-shRNA-Seq5)(CAT#: AdV-SI3787WQ)

This product is a Gm16776-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Gm16776 gene can regulate the immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell. The expression of Gm16776-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Gm16776-shRNA-Seq5
Related Target/Protein Gm16776
Region CDS
TargetSeq CAAGCTTGCAAGAGTTGGAAA
NCBI RefSeq XM_355759
Alternative Names Trbv16; Tcrb-V11
Titer >1*10^10 GC/mL
Target Gene
Gene ID 100124680
Uniprot ID A0A0B4J1H3

Related Products