shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(GOLGA8E-shRNA-Seq2)(CAT#: AdV-SI1380WQ)

This product is a GOLGA8E-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of GOLGA8E-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert GOLGA8E-shRNA-Seq2
Related Target/Protein GOLGA8E
Region CDS
TargetSeq CCCACAAGCATGGTGATCTTT
NCBI RefSeq NM_001012423
Titer >1*10^10 GC/mL
Related Diseases Prader-Willi syndrome (PWS)
Target Gene
Gene ID 390535
Uniprot ID Q08AF8

Related Products