shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Gvin1-shRNA-Seq6)(CAT#: AdV-SI3458WQ)

This product is a Gvin1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Gvin1 gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The expression of Gvin1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Gvin1-shRNA-Seq6
Related Target/Protein Gvin1
Region 3UTR
TargetSeq GAGATTGTTCCTTCGTAAATA
NCBI RefSeq NM_029000
Alternative Names GVIN1; VLIG1; GVIN1P; VLIG-1; GVINP1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 387751
Uniprot ID Q7Z2Y8

Related Products