shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Hspa4-shRNA-Seq2)(CAT#: AdV-SI3641WQ)
This product is a Hspa4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Hspa4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Hspa4-shRNA-Seq2 |
| Related Target/Protein | Hspa4 |
| Region | CDS |
| TargetSeq | GAGTGAAGATGATCGTAATAC |
| NCBI RefSeq | NM_008300 |
| Alternative Names | RY; APG-2; HSPH2; hsp70; hsp70RY; HEL-S-5a; HS24/P52 |
| Titer | >1*10^10 GC/mL |
