shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(JMJD4-shRNA-Seq1)(CAT#: AdV-SI1116WQ)

This product is a JMJD4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. JMJD proteins are mostly epigenetic regulators that demethylate histones. The expression of JMJD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert JMJD4-shRNA-Seq1
Related Target/Protein JMJD4
Region CDS
TargetSeq CAATGTCTGTGGGAGGAAGAA
NCBI RefSeq NM_023007
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 65094
Uniprot ID Q9H9V9

Related Products