shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(KIAA0802-shRNA-Seq1)(CAT#: AdV-SI1183WQ)

This product is a KIAA0802-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The KIAA0802 gene plays a role in the development and maintenance of non-centrosomal microtubule bundles at the lateral membrane in polarized epithelial cells. The expression of KIAA0802-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert KIAA0802-shRNA-Seq1
Related Target/Protein KIAA0802
Region CDS
TargetSeq GCTGCTGGAACATGCCTTAAA
NCBI RefSeq NM_015210
Alternative Names SOGA2; CCDC165; MTCL1
Titer >1*10^10 GC/mL
Related Diseases Microtubules (MTs) growth
Target Gene
Gene ID 23255
Uniprot ID Q9Y4B5

Related Products