shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(KIAA1919-shRNA-Seq3)(CAT#: AdV-SI1175WQ)

This product is a KIAA1919-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The KIAA1919 gene may function as a sodium-dependent glucose transporter is potential channel for urea in the inner medulla of kidney. The expression of KIAA1919-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert KIAA1919-shRNA-Seq3
Related Target/Protein KIAA1919
Region CDS
TargetSeq CCTGCACTCAACCAATCATCT
NCBI RefSeq NM_153369
Alternative Names NaGLT1; MFSD4B
Titer >1*10^10 GC/mL
Related Diseases Renal carcinoma
Target Gene
Gene ID 91749
Uniprot ID Q5TF39

Related Products