shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Ktn1-shRNA-Seq3)(CAT#: AdV-SI3447WQ)
This product is a Ktn1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Ktn1 gene encodes an integral membrane protein that is a member of the kinectin protein family. The expression of Ktn1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Ktn1-shRNA-Seq3 |
| Related Target/Protein | Ktn1 |
| Region | CDS |
| TargetSeq | CTCATCCCTTCAGTAGTTATT |
| NCBI RefSeq | NM_008477 |
| Alternative Names | CG1; KNT; MU-RMS-40.19 |
| Titer | >1*10^10 GC/mL |
