shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LAMP3-shRNA-Seq1)(CAT#: AdV-SI1241WQ)

This product is a LAMP3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. LAMP3 regulates hepatic lipid metabolism through activating PI3K/Akt pathway. LAMP3 promotes the invasion of osteosarcoma cells via SPP1 signaling. LAMP3 expression correlated with poor clinical outcome in human ovarian cancer. The expression of LAMP3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert LAMP3-shRNA-Seq1
Related Target/Protein LAMP3
Region CDS
TargetSeq GTCAGTCAAGACTGGAATTTA
NCBI RefSeq NM_014398
Alternative Names LAMP; CD208; DCLAMP; LAMP-3; TSC403; DC LAMP; DC-LAMP
Titer >1*10^10 GC/mL
Related Diseases Oral squamous cell carcinoma
Target Gene
Gene ID 27074
Uniprot ID Q9UQV4

Related Products