shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LIMS2-shRNA-Seq1)(CAT#: AdV-SI1151WQ)
This product is a LIMS2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. LIMS2 gene encodes a member of a small family of focal adhesion proteins which interacts with ILK (integrin-linked kinase), a protein which effects protein-protein interactions with the extraceullar matrix. The expression of LIMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | LIMS2-shRNA-Seq1 |
| Related Target/Protein | LIMS2 |
| Region | CDS |
| TargetSeq | GAAGAACAAGTTTGTGGAGTT |
| NCBI RefSeq | NM_017980 |
| Alternative Names | LGMD2W; PINCH2; MDRCMTT; PINCH-2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Muscular dystrophy, severe cardiomyopathy and triangular tongues |