shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LOC286238-shRNA-Seq1)(CAT#: AdV-SI1083WQ)
This product is a LOC286238-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. LOC286238 is an RNA Gene, and is affiliated with the ncRNA class. The expression of LOC286238-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | LOC286238-shRNA-Seq1 |
| Related Target/Protein | LOC286238 |
| Region | CDS |
| TargetSeq | CAGCAAGGAATAGCAGTGAAA |
| NCBI RefSeq | XM_379684 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cardiovascular disease (CVD) |