shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LOC286238-shRNA-Seq3)(CAT#: AdV-SI1085WQ)

This product is a LOC286238-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. LOC286238 is an RNA Gene, and is affiliated with the ncRNA class. The expression of LOC286238-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert LOC286238-shRNA-Seq3
Related Target/Protein LOC286238
Region CDS
TargetSeq GCAGGAAGACAGCAAGGAATA
NCBI RefSeq XM_379684
Titer >1*10^10 GC/mL
Related Diseases Cardiovascular disease (CVD)

Related Products