shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LOC440993-shRNA-Seq1)(CAT#: AdV-SI1502WQ)

Datasheet

This product is a LOC440993-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of LOC440993-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert LOC440993-shRNA-Seq1
Related Target/Protein LOC440993
Region CDS
TargetSeq GAAGTTGCTACTGTGATGAAT
NCBI RefSeq NM_001013714
Titer >1*10^10 GC/mL
Related Diseases Lung cancer

Related Products

shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Olfr410-shRNA-Seq1) (CAT#:AdV-SI2309WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Cenpc1-shRNA-Seq1) (CAT#:AdV-SI2589WQ) Recombinant adenovirus, pU6-(Mouse GATA4), Overexpression (CAT#:AdV-GTOH0300WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(NLRP9-shRNA-Seq1) (CAT#:AdV-SI1515WQ) Recombinant adenovirus, pU6-(Human WDR5), Overexpression (CAT#:AdV-GTOH0739WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Erc1-shRNA-Seq1) (CAT#:AdV-SI3186WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(ZDHHC15-shRNA-Seq1) (CAT#:AdV-SI2995WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(OR5M11-shRNA-Seq1) (CAT#:AdV-SI1567WQ)