shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LOC441799-shRNA-Seq2)(CAT#: AdV-SI3273WQ)

Datasheet

This product is a LOC441799-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of LOC441799-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert LOC441799-shRNA-Seq2
Related Target/Protein LOC441799
Region CDS
TargetSeq CAAGAACAGCTCAGAAGCCAA
NCBI RefSeq XM_497554
Titer >1*10^10 GC/mL

Related Products

shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SDHAF2-shRNA-Seq1) (CAT#:AdV-SI0978WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(RNPS1-shRNA-Seq1) (CAT#:AdV-SI0550WQ) Recombinant adenovirus, pU6-(Mouse Trib3), Overexpression (CAT#:AdV-GTOH0067WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(OR13F1-shRNA-Seq2) (CAT#:AdV-SI1640WQ) Recombinant adenovirus, pU6-(Human hsa-mir-494), Overexpression (CAT#:AdV-GTOH0358WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Eif2b1-shRNA-Seq1) (CAT#:AdV-SI2761WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Olfr1532-ps1-shRNA-Seq2) (CAT#:AdV-SI3733WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Armc5-shRNA-Seq1) (CAT#:AdV-SI2334WQ)