shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LOC80154-shRNA-Seq2)(CAT#: AdV-SI1253WQ)

This product is a LOC80154-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The hypothetical protein LOC80154 were predicted to have NF-kappa B binding sites. The expression of LOC80154-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert LOC80154-shRNA-Seq2
Related Target/Protein LOC80154
Region 3UTR
TargetSeq CCCATAGACTTATAAGTCTAA
NCBI RefSeq NM_025084
Titer >1*10^10 GC/mL
Related Diseases Laryngeal cancer

Related Products