shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LOC80154-shRNA-Seq2)(CAT#: AdV-SI1253WQ)
This product is a LOC80154-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The hypothetical protein LOC80154 were predicted to have NF-kappa B binding sites. The expression of LOC80154-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | LOC80154-shRNA-Seq2 |
Related Target/Protein | LOC80154 |
Region | 3UTR |
TargetSeq | CCCATAGACTTATAAGTCTAA |
NCBI RefSeq | NM_025084 |
Titer | >1*10^10 GC/mL |
Related Diseases | Laryngeal cancer |