shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LOC80154-shRNA-Seq3)(CAT#: AdV-SI1254WQ)
This product is a LOC80154-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The hypothetical protein LOC80154 were predicted to have NF-kappa B binding sites. The expression of LOC80154-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | LOC80154-shRNA-Seq3 |
| Related Target/Protein | LOC80154 |
| Region | 3UTR |
| TargetSeq | GCATGGCCTATGAAGTGTGTT |
| NCBI RefSeq | NM_025084 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Laryngeal cancer |
