shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LRRN4-shRNA-Seq2)(CAT#: AdV-SI3314WQ)
This product is a LRRN4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The LRRN4 gene may play an important role in hippocampus-dependent long-lasting memory. The expression of LRRN4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | LRRN4-shRNA-Seq2 |
Related Target/Protein | LRRN4 |
Region | CDS |
TargetSeq | GAACTGCAACTTGAGTTCCTT |
NCBI RefSeq | NM_152611 |
Alternative Names | NLRR4; NLRR-4; C20orf75; dJ1056H1.1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Nervous system disease |