shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LSM14B-shRNA-Seq4)(CAT#: AdV-SI1424WQ)
This product is a LSM14B-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The LSM14B gene may play a role in control of mRNA translation. The expression of LSM14B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | LSM14B-shRNA-Seq4 |
| Related Target/Protein | LSM14B |
| Region | CDS |
| TargetSeq | CTTTGATTTCGAGAGTGCAAA |
| NCBI RefSeq | NM_144703 |
| Alternative Names | FT005; LSM13; FAM61B; RAP55B; C20orf40; bA11M20.3 Expression |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |