shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(MORC2-shRNA-Seq1)(CAT#: AdV-SI1377WQ)
This product is a MORC2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The MORC2 gene encodes a member of the Microrchidia (MORC) protein superfamily. The encoded protein is known to regulate the condensation of heterochromatin in response to DNA damage and play a role in repressing transcription. The expression of MORC2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | MORC2-shRNA-Seq1 |
| Related Target/Protein | MORC2 |
| Region | CDS |
| TargetSeq | CATCTATAAGTACTCTCCATT |
| NCBI RefSeq | NM_014941 |
| Alternative Names | ZCW3; CMT2Z; ZCWCC1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |