shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Mrpl43-shRNA-Seq1)(CAT#: AdV-SI3922WQ)
This product is a Mrpl43-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Mrpl43 gene help in protein synthesis within the mitochondrion. The expression of Mrpl43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Mrpl43-shRNA-Seq1 |
| Related Target/Protein | Mrpl43 |
| Region | 3UTR |
| TargetSeq | CAGATGAATCTCTGCGTTTAA |
| NCBI RefSeq | NM_053164 |
| Alternative Names | L43mt; MRP-L43; bMRP36a |
| Titer | >1*10^10 GC/mL |