shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(MUM1L1-shRNA-Seq2)(CAT#: AdV-SI1457WQ)
This product is a MUM1L1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The MUM1L1 gene encodes a protein which contains a mutated melanoma-associated antigen 1 domain. The expression of MUM1L1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | MUM1L1-shRNA-Seq2 |
Related Target/Protein | MUM1L1 |
Region | 3UTR |
TargetSeq | CCAGAATCTGAGAATTTGGAA |
NCBI RefSeq | NM_152423 |
Alternative Names | MUM1L1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Endometrial carcinoma |