shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(N4bp2l2-shRNA-Seq2)(CAT#: AdV-SI3617WQ)
This product is a N4bp2l2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The N4bp2l2 gene has enzyme binding and transcription corepressor activity. The expression of N4bp2l2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | N4bp2l2-shRNA-Seq2 |
| Related Target/Protein | N4bp2l2 |
| Region | CDS |
| TargetSeq | GCAATAATGTTCATCCCTTTA |
| NCBI RefSeq | NM_201369 |
| Alternative Names | CG005; CG016; PFAAP5; 92M18.3 |
| Titer | >1*10^10 GC/mL |