shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(N4bp2l2-shRNA-Seq7)(CAT#: AdV-SI3622WQ)

This product is a N4bp2l2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The N4bp2l2 gene has enzyme binding and transcription corepressor activity. The expression of N4bp2l2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert N4bp2l2-shRNA-Seq7
Related Target/Protein N4bp2l2
Region 3UTR
TargetSeq GGTGTTGTATTGCAATGATTA
NCBI RefSeq NM_201369
Alternative Names CG005; CG016; PFAAP5; 92M18.3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 10443
Uniprot ID Q92802

Related Products